View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0193_low_22 (Length: 287)
Name: NF0193_low_22
Description: NF0193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0193_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 26 - 278
Target Start/End: Original strand, 4378958 - 4379210
Alignment:
| Q |
26 |
atcaaggccctgtcttgtgtacagaagtaaaagtaataaattaatggcatcatacagacaataacaggtaaaggtagaatgggtatcagcaaagcaatgc |
125 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4378958 |
atcaaggccctgtcttctgtacagaagtaaaagtaataaattaatggcatcatacagacagtaacaggtaaaggtagaatgggtatcagcaaagcaatgc |
4379057 |
T |
 |
| Q |
126 |
cttcatctttatggatatgtttagtacggatttatagctagttttccttcattattattgttgtcaaaagtacatttacgtgtgcacgttttgcacnnnn |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4379058 |
cttcatctttatggatatgtttagtacggatttatagctagtttttcttcattattattgttgtcaaaagtacatttacgtgtgcacgttttgcactttt |
4379157 |
T |
 |
| Q |
226 |
nnnnnnnnnnnnnctcctacttcttaattataatttccatccatttagtatta |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4379158 |
tttagggttttttctcctacttcttaattataatttccatccatttagtatta |
4379210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University