View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0193_low_23 (Length: 286)

Name: NF0193_low_23
Description: NF0193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0193_low_23
NF0193_low_23
[»] chr7 (1 HSPs)
chr7 (63-127)||(5347437-5347501)


Alignment Details
Target: chr7 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 63 - 127
Target Start/End: Complemental strand, 5347501 - 5347437
Alignment:
63 acatcatcaaaatcttcatcttcaacatggaaacaagtttcagaattactcacagtagcttccat 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5347501 acatcatcaaaatcttcatcttcaacatggaaacaagtttcagaattactcacagtagcttccat 5347437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University