View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0193_low_31 (Length: 257)
Name: NF0193_low_31
Description: NF0193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0193_low_31 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 30 - 257
Target Start/End: Original strand, 18600559 - 18600786
Alignment:
| Q |
30 |
acaagaaagtcccaccaactaagcaacccatgaagaacatggaagctggaaggcctgtgatgatagagctctcacactgcatggcccattcagatatgat |
129 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18600559 |
acaagaaaagcccaccaactaagcaacccatgaagaacatggaagctggaagacctgtgatgatagagctctcacactgcatggcccattcagatatgat |
18600658 |
T |
 |
| Q |
130 |
ggaggcttgtggtggcccatcccaagcccatgagcctttgggaaacttacacacatcattaaatgatggtgtcgagtagcagccattcaaaatgtcaatg |
229 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18600659 |
ggaggcctgtggtggcccatcccaagcccatgagcctttgggaaacttacacacatcattaaatgatggtgtcgagtagcagccattcaaaatgtcaatg |
18600758 |
T |
 |
| Q |
230 |
ttttcaccggtgcagtgccatgatggaa |
257 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
18600759 |
ttttcaccggtgcagtgccatgatggaa |
18600786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University