View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0193_low_41 (Length: 241)
Name: NF0193_low_41
Description: NF0193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0193_low_41 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 157 - 221
Target Start/End: Original strand, 5347437 - 5347501
Alignment:
Q |
157 |
atggaagctactgtgagtaattctgaaacttgtttccatgttgaagatgaagattttgatgatgt |
221 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5347437 |
atggaagctactgtgagtaattctgaaacttgtttccatgttgaagatgaagattttgatgatgt |
5347501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 63 - 95
Target Start/End: Original strand, 5347343 - 5347375
Alignment:
Q |
63 |
aagtgatgggtttgagaggattttgtggattag |
95 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
5347343 |
aagtgatgggtttgagaggattttgtggattag |
5347375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 28578 times since January 2019
Visitors: 1218