View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0193_low_6 (Length: 409)
Name: NF0193_low_6
Description: NF0193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0193_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 7 - 381
Target Start/End: Original strand, 54964242 - 54964617
Alignment:
Q |
7 |
ggagcagagatcatgtaccatcatggctctgttagatggaggaacattgagaaggcacaagagttggtttaaggtggaaatctttcattatcttcttcaa |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54964242 |
ggagcagagatcatgtaccatcatggctctgttagatggaggaacattgagaaggcacaagagttggtttaaggtggaaatctttcattatcttcttcaa |
54964341 |
T |
 |
Q |
107 |
aggattttattttatggtatttttaatcaaatagatgtggtggtgactaacaaatagtttccgctgcaatgcaattgtaaaatcttctaatttaatttgt |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54964342 |
aggattttattttatggtatttttaatcaaatagatgtggtggtgactaacaaatagtttccgctgcaatgcaattgtaaaatcttctaatttaatttgt |
54964441 |
T |
 |
Q |
207 |
tggggattatttgacagtctaatggacttggtgtttgattatatgtatatctgtcagtttgat-nnnnnnnnttgaatcttattcaacatatttgccact |
305 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||| | | ||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
T |
54964442 |
tggggattattttacagtctaatggacttggtgtttgctaaaatgtatatctgtcagtttgataaaaaaaaattgactcttattcaacatatttgccact |
54964541 |
T |
 |
Q |
306 |
gatgcagttcattcgtactcagtcagtcagttagttttatcctttccattttttgcagccacgtctcactgatatt |
381 |
Q |
|
|
|||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54964542 |
gatgcaattcattcgtactcagtcagttagttagttttatcctttccattttttgcagccacgtctcactgatatt |
54964617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University