View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0194_high_2 (Length: 388)
Name: NF0194_high_2
Description: NF0194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0194_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 33 - 370
Target Start/End: Complemental strand, 39784660 - 39784315
Alignment:
| Q |
33 |
tgatcattgccaacaaattaagtcacccnnnnnnnnacgatttggatcttattaatatgtacctaatttctagctaattgttataaccaattggtaactg |
132 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39784660 |
tgatcattgccaacaaattaagtcacccttttttttacgatttgggtcttattaatatgtacctaatttctagctaattgttataaccaattggtaactg |
39784561 |
T |
 |
| Q |
133 |
tattactataaaataacattattcggttaattaggcttaacttgtgtgtttgagcaactgatcacttatgaacttttttatatacattttttatagcata |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39784560 |
tattactataaaataacattattcggttaattaggctttacttgtgtgtttgagcaaccgatcacttatgaacttttttatatacattttttatagcata |
39784461 |
T |
 |
| Q |
233 |
aaagtttatttgagacggactctggaaatttactagaatggggatagacttc--------aagagtgtttataaatctacttacaaatcacatcaaattt |
324 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||| ||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39784460 |
aaagtttatttgagacggactctagaaatttactggaatgggaatagacttcaaaattcaaagagtgtttataaatctatttacaaatcacatcaaattt |
39784361 |
T |
 |
| Q |
325 |
ttatctacatttactctacgtgttccattatattcttattctctct |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39784360 |
ttatctacatttactctacgtgttccattatattcttattctctct |
39784315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University