View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0194_low_1 (Length: 439)

Name: NF0194_low_1
Description: NF0194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0194_low_1
NF0194_low_1
[»] chr3 (2 HSPs)
chr3 (250-330)||(2656666-2656746)
chr3 (362-405)||(9593228-9593271)


Alignment Details
Target: chr3 (Bit Score: 53; Significance: 3e-21; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 250 - 330
Target Start/End: Complemental strand, 2656746 - 2656666
Alignment:
250 ttagagtgacctgcaaaattatgcaggttgagtgggtttggattaacataagagtgacattgtttgtgtgatttttattca 330  Q
    ||||||||||||||||||||||||||||||||||||||| | ||||||| | |||||| |||| | |||||||||||||||    
2656746 ttagagtgacctgcaaaattatgcaggttgagtgggtttagcttaacatgaaagtgaccttgtatctgtgatttttattca 2656666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 362 - 405
Target Start/End: Complemental strand, 9593271 - 9593228
Alignment:
362 agaagacttttagattagacaatgagtcaagaaataagttcaca 405  Q
    |||||||||||||| |||||||||||||||||||||| ||||||    
9593271 agaagacttttagaatagacaatgagtcaagaaataaattcaca 9593228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University