View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0194_low_12 (Length: 233)
Name: NF0194_low_12
Description: NF0194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0194_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 22 - 165
Target Start/End: Original strand, 28589374 - 28589518
Alignment:
| Q |
22 |
tgtcgatatccggcctctccatgataaataatttactaccttc---aacctcccacatacttttgtacactaaaacaaggttgaagaaaaaacacaactt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28589374 |
tgtcgatatccggcctctccatgataaataatttactaccttcttcaacctcccacatacttttgtacactaaaacaaggttgaagaaaaaaca--actt |
28589471 |
T |
 |
| Q |
119 |
aagattccagaagaagcgcatcaatatttcgttttccatcggggcct |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28589472 |
aagattccagaagaagcgcatcaatatttcgttttccatcggggcct |
28589518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University