View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0194_low_4 (Length: 362)
Name: NF0194_low_4
Description: NF0194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0194_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 198 - 350
Target Start/End: Complemental strand, 30366055 - 30365903
Alignment:
| Q |
198 |
cccattcctagaaatcataagcagctaacagagcgaaaatcgtgatttggttgagtgaaatcgaacagagcaacaacaacagtgaacatgagaacaaagg |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30366055 |
cccattcctagaaatcataagcagctaacagagcaaaaatcgtgatttggttgagtgaaatcgaacagagcaacaacaacagtgaacatgagaacaaagg |
30365956 |
T |
|
| Q |
298 |
agtggagagagaaaagaatactaccgttttgaagaatcctcaagagcaacagc |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30365955 |
agtggagagagaaaagaatactaccgttttgaagaatcctcaagagcaacagc |
30365903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 30366138 - 30366106
Alignment:
| Q |
25 |
catcatacgagaccacaaaccacaaaattcctt |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30366138 |
catcatacgagaccacaaaccacaaaattcctt |
30366106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 83; Significance: 3e-39; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 66 - 184
Target Start/End: Complemental strand, 21657969 - 21657851
Alignment:
| Q |
66 |
ttagcaattgatatgataatccatttggccttaacttgatcttcatttctagtttcattttcaccgacaaatggtttttgaaaatctatatactctttaa |
165 |
Q |
| |
|
|||| ||||||||||| |||||||||| |||| ||||||||||||| |||||||||||||||| ||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
21657969 |
ttagtaattgatatgagaatccatttgaccttgacttgatcttcatctctagtttcattttcatcgacatatgatttttgaaaatctatatactctttaa |
21657870 |
T |
|
| Q |
166 |
ttagcttgcaccttttttc |
184 |
Q |
| |
|
|||||||||| |||||||| |
|
|
| T |
21657869 |
ttagcttgcatcttttttc |
21657851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1517 times since January 2019
Visitors: 2192