View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0194_low_5 (Length: 331)
Name: NF0194_low_5
Description: NF0194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0194_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 102 - 320
Target Start/End: Complemental strand, 33301475 - 33301262
Alignment:
Q |
102 |
atatagtcccctttctactaacttttgttagtgatatcatatcatataatatctctcatctttagtatctttaatccttttgactttgctatcatctact |
201 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
33301475 |
atatagtcccctttctactaacttttgttagtgatatcatatcatataatatctctcatctttagtatctttcatccttttgactttgctatcatctact |
33301376 |
T |
 |
Q |
202 |
aagctcaaatgaaaaccactatgccactgtccatttcatcattctcacattccaattttctctcttaactgaattttcatgggttcagatctagctttgg |
301 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
33301375 |
-----caaacgaaaaccactatgccactgtccatttcatcattctcacattccaattttctctcttaactgaattttcatgggttcacatctagctttgg |
33301281 |
T |
 |
Q |
302 |
agcacaatttgcaacagct |
320 |
Q |
|
|
||||||||||||||||||| |
|
|
T |
33301280 |
agcacaatttgcaacagct |
33301262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University