View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0194_low_8 (Length: 298)
Name: NF0194_low_8
Description: NF0194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0194_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 30 - 289
Target Start/End: Complemental strand, 14469310 - 14469049
Alignment:
| Q |
30 |
ttactctcttccctgttgaatttaaagagagtatgtcttgtgatataggccattcatttcaattagatgactccccttcacctttgtaaatgtaaattct |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14469310 |
ttactctcttccctgttgaatttaaagagagtatgtcttgtgatataggccattcatttcaattagatgactccccttcacctttgtaaatgtaaattct |
14469211 |
T |
 |
| Q |
130 |
atataaatactgcattttccctcacatttataccaacaatttctgtaatttgtaggattttaagagagaaatatcagaggctttag--gaatctacaatc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
14469210 |
atataaatactgcattttccctcacatttataccaacaatttctgtaatttgtaggattttaagagagaaatatcagaggctttagatatatcaacaatc |
14469111 |
T |
 |
| Q |
228 |
atatcaatagtgtatacaattgcatccatatatgaaatatcattaaagtttctggtctctgc |
289 |
Q |
| |
|
| ||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
14469110 |
acatcaatagtgtatacaattgcatccgtatatgaaatatcattgaagtttctggtctctgc |
14469049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University