View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0194_low_9 (Length: 285)
Name: NF0194_low_9
Description: NF0194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0194_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 62 - 270
Target Start/End: Original strand, 1049330 - 1049526
Alignment:
| Q |
62 |
gttacatgcataattgtttaggtttaggtggttttgttttattgtattactttgtttcctagtttgtgattgattttatgtggatcttgtctagattgct |
161 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1049330 |
gttacatgcataattgtttaggcttaggttgttttgttttattgtattactttg------------tgattgattttatgtggatcttgtctagattgct |
1049417 |
T |
 |
| Q |
162 |
cgtaaacttgaggctatgaactcttttaaggagcctctcaactctgatttgcttaatggaaaatgggagcttttatatacaacatctcaatcaattttgc |
261 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1049418 |
cgtaaacttgaggctatgaactctgttaaggagcctctcaactctgatttgcttaatggaaaatgggagcttttatatactacatctcaatcaattttgc |
1049517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University