View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0194_low_9 (Length: 285)

Name: NF0194_low_9
Description: NF0194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0194_low_9
NF0194_low_9
[»] chr2 (1 HSPs)
chr2 (62-270)||(1049330-1049526)


Alignment Details
Target: chr2 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 62 - 270
Target Start/End: Original strand, 1049330 - 1049526
Alignment:
62 gttacatgcataattgtttaggtttaggtggttttgttttattgtattactttgtttcctagtttgtgattgattttatgtggatcttgtctagattgct 161  Q
    |||||||||||||||||||||| |||||| ||||||||||||||||||||||||            ||||||||||||||||||||||||||||||||||    
1049330 gttacatgcataattgtttaggcttaggttgttttgttttattgtattactttg------------tgattgattttatgtggatcttgtctagattgct 1049417  T
162 cgtaaacttgaggctatgaactcttttaaggagcctctcaactctgatttgcttaatggaaaatgggagcttttatatacaacatctcaatcaattttgc 261  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
1049418 cgtaaacttgaggctatgaactctgttaaggagcctctcaactctgatttgcttaatggaaaatgggagcttttatatactacatctcaatcaattttgc 1049517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University