View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0195-INSERTION-1 (Length: 605)
Name: NF0195-INSERTION-1
Description: NF0195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0195-INSERTION-1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-134; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 1 - 389
Target Start/End: Original strand, 44528115 - 44528508
Alignment:
Q |
1 |
tctaaatcccttggttcaatgtactcagaagtagccttcccgcttcttgtggattaaacagggagagttaaaagagaaaatgaaatcaagacaacaagta |
100 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
44528115 |
tctaaatcccttggttctatgtactcagaagtagccttcccgcttgttgtggattaaacagggagagttaaaagagaaaatgaaatcaacacaacaagta |
44528214 |
T |
 |
Q |
101 |
cctttaagaagtatcgtgacctcaacaaaatctttcaacaactcctatatgggaagtttaaaagtaacgtctttattattttctcaaacaaatttgtatc |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44528215 |
cctttaagaagtatcgtgacctcaacaaaatctttcaacaactcctatatgggaagtttaaaagtaacgtctttattattttctcaaacaaatttgtatg |
44528314 |
T |
 |
Q |
201 |
tcctcgtgagtttaacacatttgatacagataatgcaaaaagtatgcaaagtctggggttcgaacccccgccacnnnnnnnnnngaaaa---ttgtataa |
297 |
Q |
|
|
| ||||||||||||| || ||||||||||||||||||| |||||| ||||| ||||||||||||||| |||| || | |||||||| |
|
|
T |
44528315 |
ttttcgtgagtttaactcagttgatacagataatgcaaacagtatgtaaagtttggggttcgaaccccagccaaaaaaaaaaaaaaacaattttgtataa |
44528414 |
T |
 |
Q |
298 |
aaacattggtatctctttcaaggaaagttgtgct--actagatcaaaatttaactatcgttaaaaatttagcggtggttaactaccgctagatc |
389 |
Q |
|
|
|||||||||||||||||||||| ||||||||||| || | || | |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
44528415 |
aaacattggtatctctttcaagaaaagttgtgctgatatacaacagtagttaactatcgttaaaaatttagcggtggttaactactgctagatc |
44528508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 433 - 520
Target Start/End: Original strand, 44528513 - 44528599
Alignment:
Q |
433 |
acgttattttcatgtatttttagaatgttttgtatgttataaaagcaattttcttaaacttgtttaaaaataaaaatgcgtttatctt |
520 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
T |
44528513 |
acgttattttcatgtatttttagaatgttttgtatgttataaaagcaattttcttaaacttattt-aaaataaaaatgcgtttatctt |
44528599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 201 - 268
Target Start/End: Original strand, 32180825 - 32180892
Alignment:
Q |
201 |
tcctcgtgagtttaacacatttgatacagataatgcaaaaagtatgcaaagtctggggttcgaacccc |
268 |
Q |
|
|
|||||||||| ||| | || ||| || ||| |||||| ||| |||||||||||||||||||||||||| |
|
|
T |
32180825 |
tcctcgtgagcttagctcagttggtatagacaatgcataaaatatgcaaagtctggggttcgaacccc |
32180892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 201 - 273
Target Start/End: Complemental strand, 36662435 - 36662363
Alignment:
Q |
201 |
tcctcgtgagtttaacacatttgatacagataatgcaaaaagtatgcaaagtctggggttcgaacccccgcca |
273 |
Q |
|
|
|||||||||||||||| || ||| || ||| |||||| ||| ||| ||| ||| |||||||||||||| |||| |
|
|
T |
36662435 |
tcctcgtgagtttaactcagttggtatagacaatgcataaaatatacaaggtcaggggttcgaaccccggcca |
36662363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 201 - 268
Target Start/End: Complemental strand, 29234040 - 29233973
Alignment:
Q |
201 |
tcctcgtgagtttaacacatttgatacagataatgcaaaaagtatgcaaagtctggggttcgaacccc |
268 |
Q |
|
|
|||||||||||||| | || ||| || ||| |||||| ||| ||||||| |||||||||||||||||| |
|
|
T |
29234040 |
tcctcgtgagtttagctcagttggtatagacaatgcataaaatatgcaaggtctggggttcgaacccc |
29233973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 274
Target Start/End: Complemental strand, 9893717 - 9893664
Alignment:
Q |
221 |
ttgatacagataatgcaaaaagtatgcaaagtctggggttcgaacccccgccac |
274 |
Q |
|
|
|||||| |||||||||| ||| ||||||| ||||||||||| |||||| ||||| |
|
|
T |
9893717 |
ttgatatagataatgcataaaatatgcaaggtctggggttcaaaccccagccac |
9893664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 201 - 261
Target Start/End: Original strand, 8834925 - 8834985
Alignment:
Q |
201 |
tcctcgtgagtttaacacatttgatacagataatgcaaaaagtatgcaaagtctggggttc |
261 |
Q |
|
|
|||||||||| ||||| || |||||| ||||||||| || |||||||||||| ||||||| |
|
|
T |
8834925 |
tcctcgtgagcttaactcagttgataaggataatgcataatgtatgcaaagtccggggttc |
8834985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University