View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0195-INSERTION-6 (Length: 283)
Name: NF0195-INSERTION-6
Description: NF0195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0195-INSERTION-6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 4e-93; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 29 - 229
Target Start/End: Complemental strand, 31378309 - 31378110
Alignment:
| Q |
29 |
accttctgtggttgttggaagctgggagagacagccaagtggtggaatactatcccttttgaaaaactgtaccgaggatatgaaagaatgggaacgcaaa |
128 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31378309 |
accttcagtggttgttggaagttgggagagacagccaagtggtggaatactatcccgtttgaaaat-tgtaccgaggatatgaaagaatgggaacgcaaa |
31378211 |
T |
|
| Q |
129 |
ttgagaaacaaatatcgagactccattgaagggtgtagggaaaagatgggaaggcagagggatagtgtccaaatggcacaaatagaaagatacaaggaat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31378210 |
ttgagaaacaaatatcgagactccattgaagagtgtagggaaaagatgggaaggcagagggatagtgtccaaatggcacaaatagaaagatacaaggaat |
31378111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 226 - 282
Target Start/End: Complemental strand, 31378416 - 31378360
Alignment:
| Q |
226 |
aattcgtttaatggttgtaatatgcaattaactactgaaaagataacacaattcaac |
282 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
31378416 |
aatttgtttaatggttgtaatatgcgattaactactgaaaaaataacacaattcaac |
31378360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 8 - 62
Target Start/End: Complemental strand, 31378364 - 31378310
Alignment:
| Q |
8 |
tcaaccccctctatttttctcaccttctgtggttgttggaagctgggagagacag |
62 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
31378364 |
tcaaccccctctgtttttctcaccttcagtggttgttggaagctgagagagacag |
31378310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1432 times since January 2019
Visitors: 2192