View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0196_high_1 (Length: 205)

Name: NF0196_high_1
Description: NF0196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0196_high_1
NF0196_high_1
[»] scaffold0200 (1 HSPs)
scaffold0200 (1-109)||(31181-31289)


Alignment Details
Target: scaffold0200 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: scaffold0200
Description:

Target: scaffold0200; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 31289 - 31181
Alignment:
1 accatgactacaggggtgatgtagaggctcaattgagcccattccttagacaaattgatagtaggtggctttgtttaaggtctttcattgtagattcagg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31289 accatgactacaggggtgatgtagaggctcaattgagcccattccttagacaaattgatagtaggtggctttgtttaaggtctttcattgtagattcagg 31190  T
101 tatattctt 109  Q
    ||| |||||    
31189 tattttctt 31181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1504 times since January 2019
Visitors: 2192