View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0196_low_3 (Length: 205)
Name: NF0196_low_3
Description: NF0196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0196_low_3 |
 |  |
|
[»] scaffold0200 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0200 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: scaffold0200
Description:
Target: scaffold0200; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 31289 - 31181
Alignment:
Q |
1 |
accatgactacaggggtgatgtagaggctcaattgagcccattccttagacaaattgatagtaggtggctttgtttaaggtctttcattgtagattcagg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31289 |
accatgactacaggggtgatgtagaggctcaattgagcccattccttagacaaattgatagtaggtggctttgtttaaggtctttcattgtagattcagg |
31190 |
T |
 |
Q |
101 |
tatattctt |
109 |
Q |
|
|
||| ||||| |
|
|
T |
31189 |
tattttctt |
31181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1438 times since January 2019
Visitors: 2192