View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0197AE20 (Length: 239)
Name: NF0197AE20
Description: NF0197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0197AE20 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 9 - 239
Target Start/End: Complemental strand, 21658680 - 21658450
Alignment:
| Q |
9 |
ccctctgggctgctcaggccaaggatatcaccatagttgttccaaaggttctaccaaatattgtgaaagatgtgcaagtaattgaaggggatggaggggt |
108 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21658680 |
ccctctgggctgctcagtccaaggatatcaccttagttgttccaaaggttctaccaaatattgtgaaagatgtgcaagtaattgaaggggatggaggggt |
21658581 |
T |
 |
| Q |
109 |
tggtaccaaactcatctttaattttttgcctggtaagtataccttctctctctaggtcatggctctcgccgggattttgattgcatcgcctgttttttaa |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21658580 |
tggtaccaaactcatctttaattttttgcctggtaagtataccttctctctctaggtcacggccctcgctgggattttgattgcatcgcctgttttttaa |
21658481 |
T |
 |
| Q |
209 |
atgctctaaaacatcgttgtaaaataatcat |
239 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |
|
|
| T |
21658480 |
atgccctaaaacatcgttgtaaaataatcat |
21658450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University