View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0197AE29 (Length: 369)
Name: NF0197AE29
Description: NF0197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0197AE29 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 7 - 369
Target Start/End: Complemental strand, 38717290 - 38716928
Alignment:
| Q |
7 |
atccgtgtcaccgcgatgagctgcaccaacaagacgctgcgacatctctgtttcgtagtcaattggaaaaacctgtttccttagccctgtactaggactc |
106 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38717290 |
atccgtgtcaccacgatgagctgcatcaacaagacgctgcgacatctctgtttcgtagtcaattggaaaaacctgtttccttagccctgtactaggactc |
38717191 |
T |
|
| Q |
107 |
accaacgccatcatttttgttttagtctcccaaactatgttgttttagtgttggttttttaaggaatgaaatgtgtccgtgattttcgatagaaaccaga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38717190 |
accaacgccatcatttttgttttagtctccgaaactatgttgttttagtgtttgttttttaaggaatgaaatgtgtccgtgattttcgatagaaaccaga |
38717091 |
T |
|
| Q |
207 |
aatgaaggcagaggagggaaatcgggcttctgattgatgtttatatagtatagtaggtcgtgtattagggaaaattcatatttacccgtaataaaatgtg |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38717090 |
aatgaaggcagaggagggaaatcgggcttctgattgatgtttatatagtatagtaggtcgtgtattagggaaaattcatatttacccgtaataaaatgtg |
38716991 |
T |
|
| Q |
307 |
ggtccatatcagtgtcaattaaaatcatttatttgtcttcaactatgtcataaaataatcaat |
369 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38716990 |
ggtccatatcagtgttaattaaaatcatttatttgtcttcaactatgtcataaaataatcaat |
38716928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 834 times since January 2019
Visitors: 1512