View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0197_1D_high_17 (Length: 205)

Name: NF0197_1D_high_17
Description: NF0197_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0197_1D_high_17
NF0197_1D_high_17
[»] chr3 (1 HSPs)
chr3 (11-199)||(21592691-21592879)
[»] chr2 (1 HSPs)
chr2 (123-199)||(42095134-42095210)


Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 11 - 199
Target Start/End: Complemental strand, 21592879 - 21592691
Alignment:
11 atgaaggttcaaggagaaagcctaacagatatgacttgcacaatcgccgatgggaatgggaagatgctcctcaaagggaagaaactccatggcatactcc 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21592879 atgaaggttcaaggagaaagcctaacagatatgacttgcacaatcgccgatgggaatgggaagatgctcctcaaagggaagaaactccatggcatactcc 21592780  T
111 ttgttcgtcctttaattcactttctcctttggatcatgtttctccgtctccttttccaatacgggcttctggctcttcacgcaaatctt 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
21592779 ttgttcgtcctttaattcactttctcctttggatcatgtttctccgtctccttttccaatacgggcttctggctcttcacacaaatctt 21592691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 123 - 199
Target Start/End: Original strand, 42095134 - 42095210
Alignment:
123 taattcactttctcctttggatcatgtttctccgtctccttttccaatacgggcttctggctcttcacgcaaatctt 199  Q
    |||||||| |||||||| ||| |||||||||||||||||| |||||||||| ||||| |||||||||  ||||||||    
42095134 taattcaccttctccttgggaccatgtttctccgtctcctgttccaatacgagcttccggctcttcagtcaaatctt 42095210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1752 times since January 2019
Visitors: 2197