View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0197_1D_high_17 (Length: 205)
Name: NF0197_1D_high_17
Description: NF0197_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0197_1D_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 11 - 199
Target Start/End: Complemental strand, 21592879 - 21592691
Alignment:
| Q |
11 |
atgaaggttcaaggagaaagcctaacagatatgacttgcacaatcgccgatgggaatgggaagatgctcctcaaagggaagaaactccatggcatactcc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21592879 |
atgaaggttcaaggagaaagcctaacagatatgacttgcacaatcgccgatgggaatgggaagatgctcctcaaagggaagaaactccatggcatactcc |
21592780 |
T |
|
| Q |
111 |
ttgttcgtcctttaattcactttctcctttggatcatgtttctccgtctccttttccaatacgggcttctggctcttcacgcaaatctt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21592779 |
ttgttcgtcctttaattcactttctcctttggatcatgtttctccgtctccttttccaatacgggcttctggctcttcacacaaatctt |
21592691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 123 - 199
Target Start/End: Original strand, 42095134 - 42095210
Alignment:
| Q |
123 |
taattcactttctcctttggatcatgtttctccgtctccttttccaatacgggcttctggctcttcacgcaaatctt |
199 |
Q |
| |
|
|||||||| |||||||| ||| |||||||||||||||||| |||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
42095134 |
taattcaccttctccttgggaccatgtttctccgtctcctgttccaatacgagcttccggctcttcagtcaaatctt |
42095210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1752 times since January 2019
Visitors: 2197