View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0197_1D_high_8 (Length: 288)
Name: NF0197_1D_high_8
Description: NF0197_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0197_1D_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 19913226 - 19913491
Alignment:
Q |
1 |
aggctaagagacggaggtcggagaagcagagagtttccaagtcggagaaagattccacctccaccgccgcaggagctaccggtggtggtggttcggagga |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19913226 |
aggctaagagacggaggtcggagaagcagagagtttccaagtcggacaaagattccacctccaccgccgcaggagctaccggtggtggtggttcggagga |
19913325 |
T |
 |
Q |
101 |
aattgagggttcaggtgtaacaatggggttgactaggtcagcggttggtgctgcaccaccaccttttaattgggctaatgcaacaacaaagcaagttgtt |
200 |
Q |
|
|
|||||| ||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19913326 |
aattgaaggttcaggtgtaacaatggggttgaataggtcaacggttggtgctgcaccaccaccttttaattgggctaatgcaacaacaaagcaagttgtt |
19913425 |
T |
 |
Q |
201 |
cttggtgatgttttaggaaaagggaaaattggggttggttttcaaggattgtttacacaaccatct |
266 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19913426 |
cttggtgatgttttaggaaaagggaaaattggggttggttttcaaggattgtttacacaaccatct |
19913491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1449 times since January 2019
Visitors: 2192