View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0197_1D_high_8 (Length: 288)

Name: NF0197_1D_high_8
Description: NF0197_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0197_1D_high_8
NF0197_1D_high_8
[»] chr5 (1 HSPs)
chr5 (1-266)||(19913226-19913491)


Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 19913226 - 19913491
Alignment:
1 aggctaagagacggaggtcggagaagcagagagtttccaagtcggagaaagattccacctccaccgccgcaggagctaccggtggtggtggttcggagga 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
19913226 aggctaagagacggaggtcggagaagcagagagtttccaagtcggacaaagattccacctccaccgccgcaggagctaccggtggtggtggttcggagga 19913325  T
101 aattgagggttcaggtgtaacaatggggttgactaggtcagcggttggtgctgcaccaccaccttttaattgggctaatgcaacaacaaagcaagttgtt 200  Q
    |||||| ||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19913326 aattgaaggttcaggtgtaacaatggggttgaataggtcaacggttggtgctgcaccaccaccttttaattgggctaatgcaacaacaaagcaagttgtt 19913425  T
201 cttggtgatgttttaggaaaagggaaaattggggttggttttcaaggattgtttacacaaccatct 266  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19913426 cttggtgatgttttaggaaaagggaaaattggggttggttttcaaggattgtttacacaaccatct 19913491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1449 times since January 2019
Visitors: 2192