View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0197_1D_low_11 (Length: 288)
Name: NF0197_1D_low_11
Description: NF0197_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0197_1D_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 19913226 - 19913491
Alignment:
| Q |
1 |
aggctaagagacggaggtcggagaagcagagagtttccaagtcggagaaagattccacctccaccgccgcaggagctaccggtggtggtggttcggagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19913226 |
aggctaagagacggaggtcggagaagcagagagtttccaagtcggacaaagattccacctccaccgccgcaggagctaccggtggtggtggttcggagga |
19913325 |
T |
|
| Q |
101 |
aattgagggttcaggtgtaacaatggggttgactaggtcagcggttggtgctgcaccaccaccttttaattgggctaatgcaacaacaaagcaagttgtt |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19913326 |
aattgaaggttcaggtgtaacaatggggttgaataggtcaacggttggtgctgcaccaccaccttttaattgggctaatgcaacaacaaagcaagttgtt |
19913425 |
T |
|
| Q |
201 |
cttggtgatgttttaggaaaagggaaaattggggttggttttcaaggattgtttacacaaccatct |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19913426 |
cttggtgatgttttaggaaaagggaaaattggggttggttttcaaggattgtttacacaaccatct |
19913491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1832 times since January 2019
Visitors: 2198