View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0197_1D_low_12 (Length: 269)
Name: NF0197_1D_low_12
Description: NF0197_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0197_1D_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 45179034 - 45179281
Alignment:
| Q |
1 |
attgcaattgtgtgtgtgcgcgcgcacgtgtttacacacactatgttttatgaatttataaatattatgtatcctatcttatatttgnnnnnnntaatca |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45179034 |
attgcaattgtgtgtgtccgcgcgcacgtgtttacacacactatgttttatgaatttataaatattatgtatcctatcttatatttgaaaaaaataatca |
45179133 |
T |
|
| Q |
101 |
tcgctatatcatattcatatccagattctggtaacacatttgtgcacaacacaatattgcaactaactttcggatatacttaatatttcataacttaagc |
200 |
Q |
| |
|
|| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45179134 |
tccctaaatcatattcatatccagattctggtaacacatttgtgcacaacacaatattgcaactaac-ttcggatatacttaatatttcataacttaagc |
45179232 |
T |
|
| Q |
201 |
taagaactactcacttgacactggatctttacttcttttcacttctata |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45179233 |
taagaactactcacttgacactggatctttacttcttttcacttctata |
45179281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1675 times since January 2019
Visitors: 2195