View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0197_1D_low_13 (Length: 266)
Name: NF0197_1D_low_13
Description: NF0197_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0197_1D_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 41 - 257
Target Start/End: Complemental strand, 27725629 - 27725416
Alignment:
| Q |
41 |
ttgagctcatggactccatcaacttcaccaaccaaatcactactagctcaactcatccacacttcacttggattgcaagcgtcttcacaatatctggaca |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27725629 |
ttgagctcatggactccatcaacttcaccaaccaaatcacta---gctcaactcatccacacttcacttggattgcaagcgtcttcacaacatctggaca |
27725533 |
T |
 |
| Q |
141 |
accatcattgccaccggtgaaagttgctttgaccattggaaccgaacaagttggttttcctaagcatagctgctcaaattacagtcacacagaacatgtt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27725532 |
accatcattgccaccggtgaaagttgctttgaccattggaaccgaacaagttggttttcctaagcatagctgctcaaattacagtcacacagaacatgtt |
27725433 |
T |
 |
| Q |
241 |
atttatcaccttcatat |
257 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
27725432 |
atttatcaccttcatat |
27725416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University