View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0197_1D_low_22 (Length: 210)
Name: NF0197_1D_low_22
Description: NF0197_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0197_1D_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 1374758 - 1374571
Alignment:
| Q |
17 |
ggccatcaacggtataataaagattggaaaatgaaaagtaaatgggaatcatactgaaggtatgtaagccattgcaaacagtagaaggtaagaggcctga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1374758 |
ggccatcaacggtataataaagattggaaaatgaaaagtaaatgggaatcatactgaaggtatgtaagccattgcaaacagtagaaggtaagaggcctga |
1374659 |
T |
|
| Q |
117 |
tatttagcgtctgaagatgattttcagaccacgaatggctttgagactttttggaatgcaatagtaaaagtttgcctaataacctcat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1374658 |
tatttagcgtctgaagatgattttcagaccacgaatggctttgagactttttggaatgcaatggtaaaagtttgcctaataacctcat |
1374571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1715 times since January 2019
Visitors: 2196