View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0197_1D_low_23 (Length: 209)
Name: NF0197_1D_low_23
Description: NF0197_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0197_1D_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 3e-96; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 6 - 199
Target Start/End: Original strand, 29104846 - 29105039
Alignment:
| Q |
6 |
acagagaaggattcagcgtctaagcaagcctggttcatggttaatatctggtaaaactctttttggagcctcttcatagcgatttgcattaggttttgtg |
105 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
29104846 |
acagagaaggattcagcgtctaagcaggcctggttcatggttaatatctggtaaaactctttttggagcctcttcatagcgatttgcattaggttttgag |
29104945 |
T |
 |
| Q |
106 |
catggatgagtttcggagacgatggttcgagctcgagtaacgagtgcatggctctttgaagttggtgaacatggtgaatatactgaatggcttc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
29104946 |
catggatgagtttcggagacgatggttcgagctcgagtaacgagtgcatggctctttgaagttggttaacgtggtgaatatactgaatggcttc |
29105039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 9 - 200
Target Start/End: Original strand, 29090588 - 29090779
Alignment:
| Q |
9 |
gagaaggattcagcgtctaagcaagcctggttcatggttaatatctggtaaaactctttttggagcctcttcatagcgatttgcattaggttttgtgcat |
108 |
Q |
| |
|
||||||||||||| ||||||| | ||||||||||||||||| |||||||| || ||||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
29090588 |
gagaaggattcagagtctaagtatgcctggttcatggttaagatctggtagaattctttttggagcctcttcatagcaatttgcattaggttttgtgcgt |
29090687 |
T |
 |
| Q |
109 |
ggatgagtttcggagacgatggttcgagctcgagtaacgagtgcatggctctttgaagttggtgaacatggtgaatatactgaatggcttca |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| ||||||||||||||| |
|
|
| T |
29090688 |
ggatgagttctggagacgatggttcgagctcgagtaacgagtgcatggctctttgaagttggttaacgtggtgaatgtactgaatggcttca |
29090779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University