View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0197_2D_high_14 (Length: 262)
Name: NF0197_2D_high_14
Description: NF0197_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0197_2D_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 6e-83; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 41826659 - 41826500
Alignment:
| Q |
1 |
ttggtgtagctttacttgcttggaatcaatctgaggaatttgtatatgcctactatgtgcttcgcacaatttcgtatataatcagtaaaggaagtatttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41826659 |
ttggtgtagctttacttgcttggaatcaatctgaggaatttgtatatgcatactatgtgcttcgcacaatttcgtatataatcagtaaaggaagtatttt |
41826560 |
T |
 |
| Q |
101 |
ctgcatctctgtcgcgtatgtggtgagatttttatcttaatttaactaaattttgaaaag |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41826559 |
ctgcatctctgtcgcgtatgtggtgagatttttatcttaatttaactaaattttgaaaag |
41826500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 5 - 133
Target Start/End: Complemental strand, 41820008 - 41819880
Alignment:
| Q |
5 |
tgtagctttacttgcttggaatcaatctgaggaatttgtatatgcctactatgtgcttcgcacaatttcgtatataatcagtaaaggaagtattttctgc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |||| |||||| |||||||||| |||||| |
|
|
| T |
41820008 |
tgtagctttacttgcttggaatcaatctaaggaatttgtatatgcctactatgtgcttcgcacattttcgcatattatcagtcaaggaagtatcttctgc |
41819909 |
T |
 |
| Q |
105 |
atctctgtcgcgtatgtggtgagattttt |
133 |
Q |
| |
|
|| |||||||||||||||||||| ||||| |
|
|
| T |
41819908 |
atttctgtcgcgtatgtggtgaggttttt |
41819880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 168 - 243
Target Start/End: Original strand, 41826710 - 41826785
Alignment:
| Q |
168 |
gaatcatacgtaataatgagagtttacactatcaatcaatcataaccgttagatcattgaaaacgttcaacttttt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
41826710 |
gaatcatacgtaataatgagagtttacactatcaatcaatcataatcgttagatcattgaaaacattcaacttttt |
41826785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 190 - 229
Target Start/End: Complemental strand, 4076104 - 4076065
Alignment:
| Q |
190 |
tttacactatcaatcaatcataaccgttagatcattgaaa |
229 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4076104 |
tttacactatcaatcaatcataatcgttagatcattgaaa |
4076065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 1148500 - 1148466
Alignment:
| Q |
1 |
ttggtgtagctttacttgcttggaatcaatctgag |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
1148500 |
ttggtgtagctttacttgcttggaatcaatctgag |
1148466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 2830514 - 2830543
Alignment:
| Q |
1 |
ttggtgtagctttacttgcttggaatcaat |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2830514 |
ttggtgtagctttacttgcttggaatcaat |
2830543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 193 - 230
Target Start/End: Original strand, 33657402 - 33657439
Alignment:
| Q |
193 |
acactatcaatcaatcataaccgttagatcattgaaaa |
230 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
33657402 |
acactatcaatcaatcataaccgtcaaatcattgaaaa |
33657439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University