View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0197_2D_high_16 (Length: 239)
Name: NF0197_2D_high_16
Description: NF0197_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0197_2D_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 9 - 220
Target Start/End: Original strand, 783932 - 784140
Alignment:
| Q |
9 |
ttatactttagaattgtttgaatacatgattacaattgtgtgatagcaatatgagttatgatatagtagttgttaattattaatgtatgctattttatgg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
783932 |
ttatactttagaattgtttgaatacatgattacaattgtgtgataacaatatgagttatgatatagtagttgttaatta---atgtatgctattttatgg |
784028 |
T |
 |
| Q |
109 |
atatggaaaatcatttacaataaattagttgtttgatgcctaaaatttagtacgatgatgtccacaatttctagctcaaccggttaaatatgccgaaatt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
784029 |
atatggaaaatcatttacaataaattagctgtttgatgcctaaaatttagtacgatgatgtccacaatttctagctcaaccggttaaatatgccgaaatt |
784128 |
T |
 |
| Q |
209 |
gctagaggttta |
220 |
Q |
| |
|
|||||||||||| |
|
|
| T |
784129 |
gctagaggttta |
784140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University