View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0197_2D_high_21 (Length: 206)
Name: NF0197_2D_high_21
Description: NF0197_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0197_2D_high_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 25 - 187
Target Start/End: Complemental strand, 26309294 - 26309132
Alignment:
| Q |
25 |
acaaagcttgtattgtccaagatatgagttccattcgtctaaatatatttcatacatgtgagtttctttttcaaaatatgtggtacatatatgatcttaa |
124 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
26309294 |
acaaagcttgtattgtccaaaatatgagttccattcgtctaaatatatttcatacatgtgagtttattttccaaaatatgtggtacatatatgatcttaa |
26309195 |
T |
 |
| Q |
125 |
gcaaaatataatttacatgattatgtttgattgtttaggttattgcactataattgagcatga |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26309194 |
gcaaaatataatttacatgattatgtttgattgtttaggttattgcactatacttgagcatga |
26309132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 120 - 186
Target Start/End: Complemental strand, 5146607 - 5146541
Alignment:
| Q |
120 |
cttaagcaaaatataatttacatgattatgtttgattgtttaggttattgcactataattgagcatg |
186 |
Q |
| |
|
|||||||||||| |||||| | | | ||||||||| || ||||||||||||||| ||||||||||| |
|
|
| T |
5146607 |
cttaagcaaaatttaatttccctaagcatgtttgatagtctaggttattgcactagaattgagcatg |
5146541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 147 - 187
Target Start/End: Original strand, 16625404 - 16625444
Alignment:
| Q |
147 |
atgtttgattgtttaggttattgcactataattgagcatga |
187 |
Q |
| |
|
||||||||| || ||||||||||||||| |||||||||||| |
|
|
| T |
16625404 |
atgtttgatagtctaggttattgcactagaattgagcatga |
16625444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 147 - 187
Target Start/End: Complemental strand, 28836968 - 28836928
Alignment:
| Q |
147 |
atgtttgattgtttaggttattgcactataattgagcatga |
187 |
Q |
| |
|
||||||||| || ||||||||||||||| |||||||||||| |
|
|
| T |
28836968 |
atgtttgatagtctaggttattgcactagaattgagcatga |
28836928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University