View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0197_2D_low_14 (Length: 348)
Name: NF0197_2D_low_14
Description: NF0197_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0197_2D_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 1 - 334
Target Start/End: Original strand, 40648302 - 40648635
Alignment:
| Q |
1 |
tgtttgcatgttcccaaactcaatcacctttcctcgaccaggtatttgaaacagaagacccggactcaacagcacaaacagcaccaccgctatgatcacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40648302 |
tgtttgcatgttcccaaactcaatcacctttcctcgaccaggtatttgaaacagaagacccggactcaacagcacaaacagcaccaccgctatgatcacc |
40648401 |
T |
 |
| Q |
101 |
ggaccccaatcagccattttctgaaccttttgcagagcaccgaacgagagaaagaaggatttgtgtgtgaccacaagtagtttgtggccttttggaaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40648402 |
ggaccccaatcagccattttctgaaccttttgcagagcaccgaacgagagaaagaaggatttttgtgtgaccacaagtagtttgtggccttttggagaag |
40648501 |
T |
 |
| Q |
201 |
gatctagaactgtttaggaggagtaggagagacgtttatgtttgatttgatttgagggtttgtgcacacgaaataagataattgtatgattgccacgtgt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40648502 |
gatctagaactgtttaggaggagtaggagagacgtttatgtttgatttgatttgagggtttgtgcacacgaaataagataattgtatgattgccacgtgt |
40648601 |
T |
 |
| Q |
301 |
caggtctgatttcgatttaacggctcagatgatg |
334 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| |
|
|
| T |
40648602 |
ccggtctgatttcgatttaacggctcagatgatg |
40648635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University