View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0197_2D_low_21 (Length: 338)
Name: NF0197_2D_low_21
Description: NF0197_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0197_2D_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 90 - 324
Target Start/End: Complemental strand, 40648143 - 40647905
Alignment:
| Q |
90 |
ttatgtctgtactccgtagttcgtgtgtttctgtagtacaatacaata-----gttacgttgttgaaagatattgattgttttgtgtttggaagatacga |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40648143 |
ttatgtctgtactccgtagttcgtgtgtttgtgtagtacaatacaatacaatagttacgttgttgaaagatattgattgttttgtgtttggaagatacga |
40648044 |
T |
 |
| Q |
185 |
tttgtgattctgtttgcgtttttaacttttttcatcatagcacttgtcaactgaaattgaaaagcggacaaggaaaaggtaaaggcagacccttttgctc |
284 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40648043 |
tttgtgattctgtttgagtttttaacttttttcatcatagcacttgtcaactgaaattgaaaagcggacaaggaaaaggtaaaggcagaccc-tttgctc |
40647945 |
T |
 |
| Q |
285 |
ctccaaaattgattctagtgtttttcagaaaatagaaaag |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40647944 |
ctccaaaattgattctagtgtttttcagaaaatagaaaag |
40647905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 40648220 - 40648166
Alignment:
| Q |
1 |
tacactgggtaaatataattaacatactggatggggatctagatcgatcgatgca |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40648220 |
tacactgggtaaatataattaacatactggatggggatctagatcgatcgatgca |
40648166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University