View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0197_2D_low_27 (Length: 299)
Name: NF0197_2D_low_27
Description: NF0197_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0197_2D_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 77 - 280
Target Start/End: Complemental strand, 12552231 - 12552026
Alignment:
Q |
77 |
aaaattgacgtct--aacacttagtgatggaattagagacgaaattattttttccgtctgtgaaattccgtcgctatctttagagtgatttcaatatcat |
174 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12552231 |
aaaattgacgtctctaacacttagtgatggaattagagacgaaattattttttccgtctctgaaattccgtcgctatctttagagtgatttcaatatcat |
12552132 |
T |
 |
Q |
175 |
tttctacataagaaaaaacaagttaagaaatatacttgtttccaagaactgaatgaaggttgatgataactctttcttcttcatctgtgaatttccctct |
274 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
12552131 |
tttctacataagaaaaaacaagataagaaatatacttgtttccaagaactgaatgaaggttgatgataactctttcttcttcatcagtgaatttccctct |
12552032 |
T |
 |
Q |
275 |
cttgat |
280 |
Q |
|
|
|||||| |
|
|
T |
12552031 |
cttgat |
12552026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University