View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0197_2D_low_29 (Length: 263)
Name: NF0197_2D_low_29
Description: NF0197_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0197_2D_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 135 - 245
Target Start/End: Original strand, 40402106 - 40402216
Alignment:
Q |
135 |
cctgatcggtagaatcggggacggatttgaaactacgaagaagatgatcatgaagaacaaagtaacgttttctagaaaattgaagtccaaaacggttaca |
234 |
Q |
|
|
||||||||||||||| ||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40402106 |
cctgatcggtagaattgggaatggatttgaaactacgaagaagatgatcatgaagaacaaagtaacgttttctagaaaattgaagtccaaaacggttaca |
40402205 |
T |
 |
Q |
235 |
acgaattaggt |
245 |
Q |
|
|
||||||||||| |
|
|
T |
40402206 |
acgaattaggt |
40402216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 40401971 - 40402059
Alignment:
Q |
1 |
tctcacaggatcctgaagnnnnnnncttacaatttcacataatcgattctaaaaacaaaaacaaactcaattttgtagtgatttcaacc |
89 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40401971 |
tctcacaggatcctgaagaaaaaaacttacaatttcacataatcgattctaaaaacaaaaacaaactcaattttgtagtgatttcaacc |
40402059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2382 times since January 2019
Visitors: 2400