View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0197_2D_low_34 (Length: 255)
Name: NF0197_2D_low_34
Description: NF0197_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0197_2D_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 145 - 238
Target Start/End: Complemental strand, 1500310 - 1500217
Alignment:
Q |
145 |
ttgtaacttccattatttttatggnnnnnnngaagagaccacactagttatggtataaagctatttaccatatcaaatatacatacatgcatac |
238 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1500310 |
ttgtaacttccattatttttatggaaaaaaagaagagaccacactaggtatggtataaagctatttaccatatcaaatatacatacatgcatac |
1500217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2440 times since January 2019
Visitors: 2401