View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0197_2D_low_34 (Length: 255)

Name: NF0197_2D_low_34
Description: NF0197_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0197_2D_low_34
NF0197_2D_low_34
[»] chr5 (1 HSPs)
chr5 (145-238)||(1500217-1500310)


Alignment Details
Target: chr5 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 145 - 238
Target Start/End: Complemental strand, 1500310 - 1500217
Alignment:
145 ttgtaacttccattatttttatggnnnnnnngaagagaccacactagttatggtataaagctatttaccatatcaaatatacatacatgcatac 238  Q
    ||||||||||||||||||||||||       |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
1500310 ttgtaacttccattatttttatggaaaaaaagaagagaccacactaggtatggtataaagctatttaccatatcaaatatacatacatgcatac 1500217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2440 times since January 2019
Visitors: 2401