View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0197_2D_low_40 (Length: 217)
Name: NF0197_2D_low_40
Description: NF0197_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0197_2D_low_40 |
 |  |
|
[»] chr8 (6 HSPs) |
 |  |
|
[»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 46 - 217
Target Start/End: Original strand, 38609192 - 38609363
Alignment:
Q |
46 |
acctgctctgctcttgatggacgtggtgattgtgctgctgatgtcactgctgcagcaggtgtgtctcccatgcctcaggtcaagccaatggttgagattg |
145 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||| ||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38609192 |
acctgctctgctcttgatggacgtggtggttgtgctgctggtgtcactactacagcaggtgtgtctcccatgcctcaggtcaagccaatggttgagattg |
38609291 |
T |
 |
Q |
146 |
aagatcaccatggcctgtgagtgcgatgcttcgatgatgatgaagattgcggtttagttctttctctgctga |
217 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38609292 |
aagatcaccatggcctgtgagtgcgatgcttcgatgatgatgaagattgcggtttagttctttctctgctga |
38609363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 46 - 217
Target Start/End: Original strand, 38793975 - 38794146
Alignment:
Q |
46 |
acctgctctgctcttgatggacgtggtgattgtgctgctgatgtcactgctgcagcaggtgtgtctcccatgcctcaggtcaagccaatggttgagattg |
145 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||| ||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38793975 |
acctgctctgctcttgatggacgtggtggttgtgctgctggtgtcactactacagcaggtgtgtctcccatgcctcaggtcaagccaatggttgagattg |
38794074 |
T |
 |
Q |
146 |
aagatcaccatggcctgtgagtgcgatgcttcgatgatgatgaagattgcggtttagttctttctctgctga |
217 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38794075 |
aagatcaccatggcctgtgagtgcgatgcttcgatgatgatgaagattgcggtttagttctttctctgctga |
38794146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 46 - 217
Target Start/End: Complemental strand, 38120931 - 38120757
Alignment:
Q |
46 |
acctgctctgctcttgatggacgtggtgattgtgctgctgatgtcactgctgcagcaggtgtgtctcccatgcctcaggtcaagccaatggttgagattg |
145 |
Q |
|
|
||||||||||||| |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38120931 |
acctgctctgctcctgatggacgtggtggttgtgctgctgatgtcactactgcagcaggtgtgtctcccatgcctcaggtcaagccaatggttgagattg |
38120832 |
T |
 |
Q |
146 |
aagatcaccatggcctgtgagtgcgatgcttcgatgatg---atgaagattgcggtttagttctttctctgctga |
217 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
38120831 |
aagatcaccatggcctgtgagtgcgatgcttcgatgatgatgatgaagattgcggtttagttctttctctgctga |
38120757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 100 - 210
Target Start/End: Original strand, 34592844 - 34592957
Alignment:
Q |
100 |
gcaggtgtgtctcccatgcctcaggtcaagccaatggttgagattgaagatcaccatggcctgtgagtgcgatgcttc---gatgatgatgaagattgcg |
196 |
Q |
|
|
||||||||||||||| |||||| ||||| |||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
T |
34592844 |
gcaggtgtgtctcccgtgcctcgggtcaggccaatggttgagattgaagatcaccatggcctgtgagtgtgatgcttcaatgatgatgatgaagattgcg |
34592943 |
T |
 |
Q |
197 |
gtttagttctttct |
210 |
Q |
|
|
||||| |||||||| |
|
|
T |
34592944 |
gtttacttctttct |
34592957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 38609182 - 38609130
Alignment:
Q |
1 |
cgcctgacctggagaatctaataaagtagatgatccggctctaacacctgctc |
53 |
Q |
|
|
||||||||||||||||||||||||||| |||| |||||||| ||||||||||| |
|
|
T |
38609182 |
cgcctgacctggagaatctaataaagttgatgctccggctccaacacctgctc |
38609130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 38793965 - 38793913
Alignment:
Q |
1 |
cgcctgacctggagaatctaataaagtagatgatccggctctaacacctgctc |
53 |
Q |
|
|
||||||||||||||||||||||||||| |||| |||||||| ||||||||||| |
|
|
T |
38793965 |
cgcctgacctggagaatctaataaagttgatgctccggctccaacacctgctc |
38793913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 120; Significance: 1e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 46 - 217
Target Start/End: Complemental strand, 28730505 - 28730334
Alignment:
Q |
46 |
acctgctctgctcttgatggacgtggtgattgtgctgctgatgtcactgctgcagcaggtgtgtctcccatgcctcaggtcaagccaatggttgagattg |
145 |
Q |
|
|
|||||||||||||||||||| ||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
T |
28730505 |
acctgctctgctcttgatgggcgtggtggctgtgctgctgatgtcactgctgcaacaggtgtgtctcccatgcctcaggtcaggccaatgtttgagattg |
28730406 |
T |
 |
Q |
146 |
aagatcaccatggcctgtgagtgcgatgcttcgatgatgatgaagattgcggtttagttctttctctgctga |
217 |
Q |
|
|
||||||||||||||||||||||| |||| || ||| |||| |||||||||| |||| ||||||||||||||| |
|
|
T |
28730405 |
aagatcaccatggcctgtgagtgtgatggtttgatcatgacgaagattgcgatttacttctttctctgctga |
28730334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 142 - 213
Target Start/End: Original strand, 33078483 - 33078557
Alignment:
Q |
142 |
attgaagatcaccatggcctgtgagtgcgatgcttc---gatgatgatgaagattgcggtttagttctttctctg |
213 |
Q |
|
|
||||||||||||||||| |||||| ||||||||||| ||||||||||||||| |||||||| ||||||||||| |
|
|
T |
33078483 |
attgaagatcaccatgggctgtgactgcgatgcttcaatgatgatgatgaagatcgcggtttacttctttctctg |
33078557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University