View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0197_2D_low_41 (Length: 215)
Name: NF0197_2D_low_41
Description: NF0197_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0197_2D_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 9e-63; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 19 - 161
Target Start/End: Original strand, 34309489 - 34309631
Alignment:
| Q |
19 |
catccatcacttcttacattaggacgttgcaatcctaatactttgttacgtggcctcctcgcacgatgggggcaccagccataacatttacnnnnnnntt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
34309489 |
catccatcacttcttacattaggacgttgcaatcctaatactttgttacgtggcctcctcgcacgatgggggcaccagccataacatttacaaaaaaatt |
34309588 |
T |
 |
| Q |
119 |
gcctgacacgatgtttcacgttcggatccaaacagacagattt |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34309589 |
gcctgacacgatgtttcacgttcggatccaaacagacagattt |
34309631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 198
Target Start/End: Complemental strand, 34309690 - 34309649
Alignment:
| Q |
157 |
gatttgataatgaacctatggatttatccgttggtgttgaag |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34309690 |
gatttgataatgaacctatggatttatccgttggtgttgaag |
34309649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University