View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0197_high_12 (Length: 316)
Name: NF0197_high_12
Description: NF0197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0197_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 30 - 172
Target Start/End: Complemental strand, 18769551 - 18769409
Alignment:
| Q |
30 |
ctttgatggacatggtggttgctataatagcttgataactaagaagctacaacgatgtgtgtgtttgttggttgtgttaaaatctctactcaccaaattt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18769551 |
ctttgatggacatggtggttgctataatagcttgataactaagaagctacaacgatgtgtgtgtttgttggttgtgttaaaatctctactcaccaaattt |
18769452 |
T |
|
| Q |
130 |
agatcttgtttctagcacaaggtttgcttttatatatagtgag |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18769451 |
agatcttgtttctagcacaaggtttgcttttatatatagtgag |
18769409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 208 - 307
Target Start/End: Complemental strand, 18769373 - 18769274
Alignment:
| Q |
208 |
gtttggtgaaccctcccaatgtgaatgtgtttatatcatgttcaaatgttatttggacagccattcagttatccaacaatgtatttatttatagaataat |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18769373 |
gtttggtgaaccctcccaatgtgaatgtgtttatatcatgtccaaatgttatttggactgccattcagttatccaacaatgtatttatttatagaataat |
18769274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1047 times since January 2019
Visitors: 1522