View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0197_high_15 (Length: 254)
Name: NF0197_high_15
Description: NF0197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0197_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 3 - 126
Target Start/End: Original strand, 20752923 - 20753046
Alignment:
Q |
3 |
tttttcagctgcaaccaaatataccatggcgagtcaaacaaaatttgttgattttatgcaaatattagcaaaacaaaaattttatattactattaccaat |
102 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
20752923 |
tttttcagctgcaaccaaatataccatggcaagtcaaacaaaatttgttgattttatgcaaatattagcaaaacaaaatttttatattactattaccaat |
20753022 |
T |
 |
Q |
103 |
aatcaatatgcatgccccaacata |
126 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
20753023 |
aatcaatatgcatgccccaacata |
20753046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University