View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0197_low_13 (Length: 313)
Name: NF0197_low_13
Description: NF0197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0197_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 6e-68; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 92 - 234
Target Start/End: Complemental strand, 14501784 - 14501642
Alignment:
| Q |
92 |
ggtggtgtatggcgaaaatggcgagtttgatgatttcaatcgtcacgccaaaatattcgagtgtagccaactgcactcgtcaacttcccctgctgctcta |
191 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14501784 |
ggtggtggatggtgaaaatggcgagtttgatgatttcaatcgtcacgccaaaatattcgagtgtagccaactgcactcgtcaacttcacctgctgctcta |
14501685 |
T |
|
| Q |
192 |
ctgtggaggagtgtgaaagtatagtttatgaaaaattgcaacc |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14501684 |
ctgtggaggagtgtgaaagtatagtttatgaaaaattgcaacc |
14501642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 262 - 302
Target Start/End: Complemental strand, 14501627 - 14501587
Alignment:
| Q |
262 |
tatttttaatctccaaaagtttttcatcatgataatcctta |
302 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14501627 |
tatttttaatctccaaatgtttttcatcatgataatcctta |
14501587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1002 times since January 2019
Visitors: 1521