View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0197_low_13 (Length: 313)

Name: NF0197_low_13
Description: NF0197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0197_low_13
NF0197_low_13
[»] chr2 (2 HSPs)
chr2 (92-234)||(14501642-14501784)
chr2 (262-302)||(14501587-14501627)


Alignment Details
Target: chr2 (Bit Score: 131; Significance: 6e-68; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 92 - 234
Target Start/End: Complemental strand, 14501784 - 14501642
Alignment:
92 ggtggtgtatggcgaaaatggcgagtttgatgatttcaatcgtcacgccaaaatattcgagtgtagccaactgcactcgtcaacttcccctgctgctcta 191  Q
    ||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
14501784 ggtggtggatggtgaaaatggcgagtttgatgatttcaatcgtcacgccaaaatattcgagtgtagccaactgcactcgtcaacttcacctgctgctcta 14501685  T
192 ctgtggaggagtgtgaaagtatagtttatgaaaaattgcaacc 234  Q
    |||||||||||||||||||||||||||||||||||||||||||    
14501684 ctgtggaggagtgtgaaagtatagtttatgaaaaattgcaacc 14501642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 262 - 302
Target Start/End: Complemental strand, 14501627 - 14501587
Alignment:
262 tatttttaatctccaaaagtttttcatcatgataatcctta 302  Q
    ||||||||||||||||| |||||||||||||||||||||||    
14501627 tatttttaatctccaaatgtttttcatcatgataatcctta 14501587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1002 times since January 2019
Visitors: 1521