View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0197_low_15 (Length: 268)
Name: NF0197_low_15
Description: NF0197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0197_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 4 - 250
Target Start/End: Original strand, 19913245 - 19913491
Alignment:
| Q |
4 |
ggaggagcagagagtttccaagtcggagaaagattccacctccaccgccgcaggagctaccggtggtggtggttcggaggaaattgagggttcaggtgta |
103 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
19913245 |
ggagaagcagagagtttccaagtcggacaaagattccacctccaccgccgcaggagctaccggtggtggtggttcggaggaaattgaaggttcaggtgta |
19913344 |
T |
|
| Q |
104 |
acaatggggttgactaggtcagcggttggtgctgcaccgccaccttttaattgggctaatgcaacaacaaagcaagttgttcttggtgatgttttaggaa |
203 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19913345 |
acaatggggttgaataggtcaacggttggtgctgcaccaccaccttttaattgggctaatgcaacaacaaagcaagttgttcttggtgatgttttaggaa |
19913444 |
T |
|
| Q |
204 |
aagggaaaattggggttggttttcaaggattgtttacacaaccatct |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19913445 |
aagggaaaattggggttggttttcaaggattgtttacacaaccatct |
19913491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 973 times since January 2019
Visitors: 1519