View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0197_low_15 (Length: 268)

Name: NF0197_low_15
Description: NF0197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0197_low_15
NF0197_low_15
[»] chr5 (1 HSPs)
chr5 (4-250)||(19913245-19913491)


Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 4 - 250
Target Start/End: Original strand, 19913245 - 19913491
Alignment:
4 ggaggagcagagagtttccaagtcggagaaagattccacctccaccgccgcaggagctaccggtggtggtggttcggaggaaattgagggttcaggtgta 103  Q
    |||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
19913245 ggagaagcagagagtttccaagtcggacaaagattccacctccaccgccgcaggagctaccggtggtggtggttcggaggaaattgaaggttcaggtgta 19913344  T
104 acaatggggttgactaggtcagcggttggtgctgcaccgccaccttttaattgggctaatgcaacaacaaagcaagttgttcttggtgatgttttaggaa 203  Q
    ||||||||||||| ||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19913345 acaatggggttgaataggtcaacggttggtgctgcaccaccaccttttaattgggctaatgcaacaacaaagcaagttgttcttggtgatgttttaggaa 19913444  T
204 aagggaaaattggggttggttttcaaggattgtttacacaaccatct 250  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
19913445 aagggaaaattggggttggttttcaaggattgtttacacaaccatct 19913491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 973 times since January 2019
Visitors: 1519