View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0197_low_18 (Length: 251)
Name: NF0197_low_18
Description: NF0197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0197_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 4 - 242
Target Start/End: Original strand, 9546378 - 9546619
Alignment:
Q |
4 |
tgttgatcatgacgttgtgtatgagttttccatatgttgttatcttcgcgagacaatgatatgagnnnnnnngctacttcttcttcagttgttatatccg |
103 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
9546378 |
tgttgatcatgacgttgtgtatgagttttccatatgttgttatcttcgcgagacaatgatatgagaaaaaaagctacttcttcttcagttgttatatccg |
9546477 |
T |
 |
Q |
104 |
atgaagaactcagtacagaaacagactcattctgtactgagtttttcaccggatc---atctttcttgacccgtttggatcgtggaccagttggattctt |
200 |
Q |
|
|
||||||||||||||||||||| |||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
9546478 |
atgaagaactcagtacagaaaaagactcgttctgtactgagtttttcaccggatcattatctttcttgacccgtttggatcgtggtccagttggattctt |
9546577 |
T |
 |
Q |
201 |
tgatgattcagtttcactttctctatcttcctgaagaattat |
242 |
Q |
|
|
||| || |||||||||||| |||||||||||||||||||||| |
|
|
T |
9546578 |
tgacgactcagtttcacttcctctatcttcctgaagaattat |
9546619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University