View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0197_low_20 (Length: 250)
Name: NF0197_low_20
Description: NF0197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0197_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 5 - 177
Target Start/End: Complemental strand, 8036365 - 8036193
Alignment:
| Q |
5 |
cacaaggtttttcaaactttacaataactttggtctatggtgttttcaagtagtagtattatatattatttaatgtttatttcgggtgaaccaaacgagg |
104 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
8036365 |
cacaaggtttttcaaattttacaataactttggtctatggtgttttcaagtagtagtattatatataaattaatgtttatttcgggtgaaccaaacgagg |
8036266 |
T |
 |
| Q |
105 |
aaggtataacaggtcactttgacggttatttgatggttgtttaccgtcctcaacgaaacaatatcaagactac |
177 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8036265 |
aaggtataacaggccactttgacggttatttaatggttgtttaccgtcctcaacgaaacaatatcaagactac |
8036193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University