View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0197_low_22 (Length: 225)
Name: NF0197_low_22
Description: NF0197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0197_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 2 - 196
Target Start/End: Original strand, 39864663 - 39864857
Alignment:
| Q |
2 |
tttttccaaacaatggtctgcaagtgtgcattttgaactacatcataaggttttttgatatgtcaacgtggtcagcgcacccgcgattgaggatgcataa |
101 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||| |||||| ||||| || ||||||||||||||||||||||||||| |||||||||||||||||| | |
|
|
| T |
39864663 |
tttttccaaacaaatgtctgcaagtgtgcaacttggactacagcataaagtgttttgatatgtcaacgtggtcagcgcaaccgcgattgaggatgcatca |
39864762 |
T |
|
| Q |
102 |
gatatcatgacataatcgttctcgtccaccgccactatttaattaaaatcttcgaaactatacgcaaaggaataattttagtccatgattgaaag |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39864763 |
gatatcatgacataatcgttctcgtccaccaccactatttaattaaaatcttcgaaactatacgcaaaggaataattttagtccacgattgaaag |
39864857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 25 - 193
Target Start/End: Original strand, 36341457 - 36341621
Alignment:
| Q |
25 |
gtgtgcattttgaactacatcataaggttttttgatatgtcaacgtggtcagcgcacccgcgattgaggatgcataagatatcatgacataatcgttctc |
124 |
Q |
| |
|
||||||| |||| |||||| ||||| || ||||||| |||||||| ||| || || |||||||||||| | ||| ||||||||||||| |||| ||| |
|
|
| T |
36341457 |
gtgtgcaatttggactacaacataaagtgttttgatttgtcaacgcggttggcacaaccgcgattgaggctacatcagatatcatgacacgatcgctctt |
36341556 |
T |
|
| Q |
125 |
gtccaccgccactatttaattaaaatcttcgaaactatacgcaaaggaataattttagtccatgattga |
193 |
Q |
| |
|
|||||| ||| |||| |||||||| | ||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
36341557 |
gtccacagcctctat----ttaaaatcctggaaactatatgcaaaggaataattatagtcgatgattga |
36341621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1016 times since January 2019
Visitors: 1521