View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0198_high_2 (Length: 283)
Name: NF0198_high_2
Description: NF0198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0198_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 21 - 271
Target Start/End: Complemental strand, 52263243 - 52262993
Alignment:
| Q |
21 |
acatcatcatcaccactcaaagtacccattatttgagaatcaatatcaagaaggatctgtctcacagcaccaacatcacctctttgagctgctagatgaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52263243 |
acatcatcatcaccactcaaagtacccattatttgagaatcaatatcaagaaggatctgtctcacagcaccaacatcacctctttgagctgctagatgaa |
52263144 |
T |
|
| Q |
121 |
gctcagtatcgttgtgacgacccgttacttgctttacgtacttcttcttccctgcttgatcgatccgttttcctgagtttgaaaggaccagagctggcgc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52263143 |
gctcagtatcgttgtgacgacccgttacttgctttacgtacttcttcttccctgcttgatcgatccgttttcctgagtttgaaaggaccagagctggcgc |
52263044 |
T |
|
| Q |
221 |
cgtcgctgacgacggagatggcgacggcgatatttcggaaagtgggttctg |
271 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52263043 |
cgtcgctgacgacggagatggcgacggtgatatttcggaaagtgggttctg |
52262993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1830 times since January 2019
Visitors: 2394