View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0198_low_2 (Length: 381)
Name: NF0198_low_2
Description: NF0198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0198_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 24865228 - 24865016
Alignment:
| Q |
1 |
taattcattatggattcattttacgatatttataaagtgttatgcttgattttcaaatattttcataaccatgaagtttttaaaggatgcaactttaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24865228 |
taattcattatggattcattttacgatatttataaagtgttatgcttgattttcaaatattttcataaccatgaagtttttaaaggatgcaactttaata |
24865129 |
T |
 |
| Q |
101 |
tcgaagtttgattttggctaaacactcatgcaaatccatatttctcactttctccttcttatccgctttgtttaatacgctctcactaaactgagacaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24865128 |
tcgaagtttgattttggctaaacactcgtgcaaatccatatttctcactttctccttcttatccgctttgtttaatacgctctcactaaactgagacaat |
24865029 |
T |
 |
| Q |
201 |
tagaattcacaat |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
24865028 |
tagaattcacaat |
24865016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 187 - 361
Target Start/End: Complemental strand, 24865016 - 24864842
Alignment:
| Q |
187 |
taaactgagacaattagaattcacaattctgactcaccccatttcacttctctttttctccaaatttacaggtgcagggtaggttatctttggatatgca |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| ||||||||||||||||||||| |||| |
|
|
| T |
24865016 |
taaactgagacaattagaattcacaattctgactcaccccatttcccttctctttttctccaaaattacaggtacagggtaggttatctttggatttgca |
24864917 |
T |
 |
| Q |
287 |
gatctttctagaagttctttattatagtagcctctaattgaagggtagctaatgctttcttggcttcagtataat |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24864916 |
gatctttctagaagttctttattatagtagcctctaattgaagggtagctaatgctttcttggcttcagtataat |
24864842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University