View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0199-INSERTION-8 (Length: 140)
Name: NF0199-INSERTION-8
Description: NF0199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0199-INSERTION-8 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 1e-54; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 25 - 140
Target Start/End: Original strand, 34074883 - 34074998
Alignment:
Q |
25 |
aattccatacaactgcagtattaacaagttacatgaataagaaatgtgcttgaaagaaaaatacattgtcatttaagaaatggttatctttaatatccag |
124 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
34074883 |
aattccataaaactgcagtattaacaagttacatgaataagaaatgtgcttgaaagaaaaatacattgtcatttaagaaatggtcatctttaatatccag |
34074982 |
T |
 |
Q |
125 |
ggcaaaaagtgttctg |
140 |
Q |
|
|
|||||||||||||||| |
|
|
T |
34074983 |
ggcaaaaagtgttctg |
34074998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University