View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0199-INSERTION-9 (Length: 142)
Name: NF0199-INSERTION-9
Description: NF0199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0199-INSERTION-9 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 3e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 25 - 142
Target Start/End: Original strand, 6800485 - 6800602
Alignment:
| Q |
25 |
aattcctcgaccactcaaaccctagcttcttactcgtggtctgatatgtcgccttcaaggaatcatcgccataaactttcctcgaaacagcaaaatccca |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6800485 |
aattcctcgaccactcaaaccctagcttcttactcgtggtctgatacgtcgccttcaaggaatcatcgccataaactttcctcgaaacagcaaaatccca |
6800584 |
T |
|
| Q |
125 |
cgcattcttggcaacatc |
142 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
6800585 |
cgcattcttggcaacatc |
6800602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 983 times since January 2019
Visitors: 2388