View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0199_high_4 (Length: 373)
Name: NF0199_high_4
Description: NF0199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0199_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 30 - 259
Target Start/End: Complemental strand, 52386154 - 52385925
Alignment:
| Q |
30 |
ctctcaggcatcgtcttcgaaccattggttggtaagttaacctctctacccggctaactgttttaacttcagctttgcggttttccaaaccttgtttaac |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52386154 |
ctctcaggcatcgtcttcgaaccattggttggtaagttaacctctctacccggctaactgttttaacttcagcttcgcggttttccaaaccttgtttaac |
52386055 |
T |
|
| Q |
130 |
ttgaggctcaggcttttcgggaagaatgacatgaacgccggggtctcttccatttattgaaccttgcaccatcaatgaattattcatactctgtatgttg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52386054 |
ttgaggctcaggcttttcgggaagaatgacatgaacgccggggtctcttccatttattgaaccttgcaccatcaatgaattattcatactctgtatgttg |
52385955 |
T |
|
| Q |
230 |
ctgttcacatatgcctttcccgcttcatct |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
52385954 |
ctgttcacatatgcctttcccgcttcatct |
52385925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 243
Target Start/End: Complemental strand, 7087895 - 7087813
Alignment:
| Q |
161 |
tgaacgccggggtctcttccatttattgaaccttgcaccatcaatgaattattcatactctgtatgttgctgttcacatatgc |
243 |
Q |
| |
|
||||| || ||||||||| |||| |||||||| || | ||| | ||||||||| ||||| |||||||||||||| |||||||| |
|
|
| T |
7087895 |
tgaactccagggtctctttcattgattgaaccatgaaacatgagtgaattattgatactttgtatgttgctgttaacatatgc |
7087813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2530 times since January 2019
Visitors: 2401