View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0199_high_5 (Length: 357)
Name: NF0199_high_5
Description: NF0199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0199_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 66; Significance: 4e-29; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 207 - 280
Target Start/End: Complemental strand, 41152547 - 41152474
Alignment:
| Q |
207 |
cataattattgctcaattagtagttgcggcgacatttgatatgctgagaggcgaattgaaatccgcaattctct |
280 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41152547 |
cataattattgttcaattggtagttgcggcgacatttgatatgctgagaggcgaattgaaatccgcaattctct |
41152474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 91 - 170
Target Start/End: Original strand, 23854600 - 23854680
Alignment:
| Q |
91 |
atgacttcaccctaaaattttccataaggattgacaggc-aacaaaataggaattttcttacttaccattcccttcatctc |
170 |
Q |
| |
|
||||||||||| || | ||||||||||||||| |||||| || ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23854600 |
atgacttcaccgtagacttttccataaggattaacaggccaagaaaataggaattttcttacttaccattcccttcttctc |
23854680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University