View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0199_high_5 (Length: 357)

Name: NF0199_high_5
Description: NF0199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0199_high_5
NF0199_high_5
[»] chr2 (1 HSPs)
chr2 (207-280)||(41152474-41152547)
[»] chr8 (1 HSPs)
chr8 (91-170)||(23854600-23854680)


Alignment Details
Target: chr2 (Bit Score: 66; Significance: 4e-29; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 207 - 280
Target Start/End: Complemental strand, 41152547 - 41152474
Alignment:
207 cataattattgctcaattagtagttgcggcgacatttgatatgctgagaggcgaattgaaatccgcaattctct 280  Q
    ||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41152547 cataattattgttcaattggtagttgcggcgacatttgatatgctgagaggcgaattgaaatccgcaattctct 41152474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 91 - 170
Target Start/End: Original strand, 23854600 - 23854680
Alignment:
91 atgacttcaccctaaaattttccataaggattgacaggc-aacaaaataggaattttcttacttaccattcccttcatctc 170  Q
    ||||||||||| || | ||||||||||||||| |||||| || ||||||||||||||||||||||||||||||||| ||||    
23854600 atgacttcaccgtagacttttccataaggattaacaggccaagaaaataggaattttcttacttaccattcccttcttctc 23854680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University