View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0199_low_9 (Length: 257)
Name: NF0199_low_9
Description: NF0199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0199_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 24 - 130
Target Start/End: Complemental strand, 39776959 - 39776854
Alignment:
| Q |
24 |
gtgaaactaaatgtcgtacgagtaggaaacaatgtaaaaataataaataatcattagtattgttggtatttgaagagcaaagcaaattagaaaacatgtt |
123 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39776959 |
gtgaaactaaatgtcgttcgagtaggaaacaatgtgaaaataataaataatcattagtattgttggtatttgaagagcaaagcaaattag-aaacatgtt |
39776861 |
T |
|
| Q |
124 |
agttatt |
130 |
Q |
| |
|
||||||| |
|
|
| T |
39776860 |
agttatt |
39776854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 196
Target Start/End: Complemental strand, 39776869 - 39776828
Alignment:
| Q |
155 |
aaacatgttagtaattaaattcagagattgagaaatgacaac |
196 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39776869 |
aaacatgttagttattaaattcagagattgagaaatgacaac |
39776828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2455 times since January 2019
Visitors: 2401