View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0199_low_9 (Length: 257)

Name: NF0199_low_9
Description: NF0199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0199_low_9
NF0199_low_9
[»] chr5 (2 HSPs)
chr5 (24-130)||(39776854-39776959)
chr5 (155-196)||(39776828-39776869)


Alignment Details
Target: chr5 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 24 - 130
Target Start/End: Complemental strand, 39776959 - 39776854
Alignment:
24 gtgaaactaaatgtcgtacgagtaggaaacaatgtaaaaataataaataatcattagtattgttggtatttgaagagcaaagcaaattagaaaacatgtt 123  Q
    ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
39776959 gtgaaactaaatgtcgttcgagtaggaaacaatgtgaaaataataaataatcattagtattgttggtatttgaagagcaaagcaaattag-aaacatgtt 39776861  T
124 agttatt 130  Q
    |||||||    
39776860 agttatt 39776854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 196
Target Start/End: Complemental strand, 39776869 - 39776828
Alignment:
155 aaacatgttagtaattaaattcagagattgagaaatgacaac 196  Q
    |||||||||||| |||||||||||||||||||||||||||||    
39776869 aaacatgttagttattaaattcagagattgagaaatgacaac 39776828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University