View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0200_1D_low_13 (Length: 306)
Name: NF0200_1D_low_13
Description: NF0200_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0200_1D_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 14 - 281
Target Start/End: Complemental strand, 29656410 - 29656144
Alignment:
| Q |
14 |
gttctctttgtgccaattttaatggatggtttgacttctttgtccgaaatgtgggtcacaagttacatttaaacnnnnnnnnattataaaagttacgtta |
113 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||| ||||||| |||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
29656410 |
gttctctttgtgccaattataatggatagtttgacttctttatccgaaacgtgggtcacaagttacatttaacttttttttttttacaaaagttacgtta |
29656311 |
T |
|
| Q |
114 |
aacctattaaacaaattatagtacgcatagaataaaatgtgtttatgttgatcatacatattagactcatcttttttgcaaccgcatgtatatattagac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29656310 |
aacctattaaacaaattatagtacgcatagaataaaatgtgtttatgttgatcatacatattagactcttcttttttgcaaccgcatgtatatattagac |
29656211 |
T |
|
| Q |
214 |
tttttgatgcaagcaatagataggaaattagcaaatgtttcaaattaaccctgcaggaggtggatata |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29656210 |
tttttgatgcaagcaatagataggaaattagcaaatgtttcaaattaa-cctgcaggaggtggatata |
29656144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2233 times since January 2019
Visitors: 2399